Skip to content

Długoterminowe badanie replikacji wirusa zapalenia wątroby typu C w nie-A, nie-B zapaleniu wątroby ad

2 tygodnie ago

490 words

Wybrano pięciu pacjentów, ponieważ reprezentowali oni pięć jednoznacznych przypadków zapalenia wątroby typu non-A , nie B, po intensywnym badaniu kontrolnym oraz z uwagi na dostępność seryjnych próbek surowicy. Ponadto nie mieli oni dowodów na występowanie wcześniejszej choroby wątroby, nie otrzymywali żadnych transfuzji przed operacją na otwartym sercu, byli gotowi na długoterminową obserwację i wyrazili świadomą zgodę. Szympansy
Wybrane próbki osocza lub surowicy (zakres od 0,5 do 75 ml), uzyskane podczas ostrej lub przewlekłej fazy poporodowego zapalenia wątroby innego niż A, inne niż B od pacjentów 1,2,3 i 4, były pojedynczo inokulowane dożylnie w cztery szympansy. RNA HCV mierzono w surowicy co tydzień lub co dwa tygodnie w ciągu pierwszych sześciu miesięcy po inokulacji, a następnie co jeden do trzech miesięcy podczas obserwacji. Przeciwciało przeciwko HCV badano co tydzień przez cały okres obserwacji. Próbki pobrane z biopsji pobierano przed inokulacją oraz w odstępach jednego lub więcej tygodni podczas badania eksperymentalnego. Żadne ze zwierząt nie było wcześniej narażone na HCV.13
Testowanie anty-HCV
Próbki surowicy badano na obecność przeciwciał anty-HCV za pomocą testu immunoenzymatycznego zgodnie z instrukcjami producenta (Ortho Diagnostic Systems, Raritan, NJ). Płytki odczytywano na Ortho Autoreader II przy 490 nm, dla którego górna granica gęstości optycznej wynosi 3,0. Wartość odcięcia została ustalona jako średnia wartości trzech kontroli negatywnych plus 0,4 jednostki gęstości optycznej.
Startery oligonukleotydowe
PCR przeprowadzono jako dwuetapową reakcję z dwiema parami zagnieżdżonych starterów (patrz poniżej). Startery oligonukleotydowe zsyntetyzowano za pomocą syntezatora DNA (model 391, Applied Biosystems, Foster City, CA). Wykorzystano dwa zestawy zagnieżdżonych starterów z różnych regionów genomu HCV14. Pierwszy zestaw pochodził z trzeciego niestrukturalnego regionu genu (NS3) i składał się z pary starterów zewnętrznych, Al (54 CTGCAATACGTGTGCCACCC3 ), rozpoczynając od pozycji mapy 3011 i A2 (5 ACATGCATGTCATGATGTAT3 ), rozpoczynając od pozycji mapy 3600, i wewnętrzną parę starterów, A3 (5 AGACAGTCGATTTCAGCCTT3 ), rozpoczynając od pozycji mapy 3031 i A4 (5 TTGGTGACTGGGTGCGTCAG3 ), rozpoczynając od pozycji mapy 3580. Drugi zestaw zagnieżdżonych starterów pochodzi z czwartego niestrukturalnego genu (NS4) region i składał się z zewnętrznej pary primerów, P1 (5 GTTCGATGAGATGGAAGAGTG3 ), rozpoczynając od pozycji mapy 3764 i P2 (5 ACCAGGCAGCGTTGACAAGCC3 ), rozpoczynając od pozycji mapy 4001, i wewnętrznej pary starterów, P3 (5 CTCAGCACTTACCGTACATCG3 ), zaczynając od pozycji mapy 3788 i P4 (5 GCCCGCCAAGTATTGTATCCC3 ), rozpoczynając od pozycji mapy 3983.
Przygotowanie RNA
Podczas ekstrakcji RNA szczególną uwagę zwrócono na uniknięcie zakażenia krzyżowego. W każdym doświadczeniu kontrolę negatywną dla każdej badanej próbki poddano ekstrakcji RNA, odwrotnej transkrypcji i amplifikacji równolegle z próbką testową.
RNA przygotowano zgodnie z metodą guanidynowo-fenolowo-chloroformową. W skrócie, 100 .l próbki surowicy lub osocza zmieszano z 400 .l buforu ekstrakcyjnego (4,2 mola tiocyjanianu guanidyny na litr, 0,5 procent sodowego sarkozynizanu N-lauroilu, 25 mmol kwasu TRIS-chlorowodorowego na litr i 0,7 mola 2-merkaptoetanol na litr) i 50 .l (10X) buforu do ekstrakcji fenolu (1 mol kwasu TRIS-chlorowodorowego [pH 8.0] na litr, 0,1 mola EDTA na litr i 10% dodecylosiarczanu sodu)
[podobne: niedoczynność tarczycy u mężczyzn, badania kliniczne w polsce, płatki teff ]